paper n a lenticrisprv2 puro addgene (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc paper n a lenticrisprv2 puro addgene
Paper N A Lenticrisprv2 Puro Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 516 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+addgene+plasmid/lentiCRISPRv2+puro+(Plasmid+%2398290)/pm41932308-260-38-42
Average 98 stars, based on 516 article reviews

paper n a lenticrisprv2 puro addgene - by Bioz Stars, 2026-09

98/100 stars

Images

Virus:

Article Title: CCL3 is produced by aged neutrophils across cancers and promotes tumor growth.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit polyclonal anti-human GLUT1 Sigma-Aldrich Cat#HPA031345; RRID: AB_2673835 Rabbit monoclonal anti-cleaved Caspase-3 (clone 269518) R&D Systems Cat#MAB835; Clone 269518; RRID: AB_2243951 Goat anti-rabbit IgG, AF647 Invitrogen Cat#A21246; RRID: AB_2535814 Goat anti-rabbit IgG, AF555 Invitrogen Cat#A21428; RRID: AB_2535849 Donkey anti-goat IgG, DyLight 755 Invitrogen Cat#SA5-10091; RRID: AB_2556671 Donkey anti-goat IgG, AF647 Invitrogen Cat#A21447; RRID: AB_2535864 Anti-rabbit HRP Roche Cat#760–4311; RRID: AB_2811043 Anti-mouse HRP Roche Cat#760–4310; RRID: AB_2885182 Mouse monoclonal anti-human CD66b (clone G10F5) Bio-Rad Cat#MCA216T; Clone G10F5; RRID: AB_2291565 Rat monoclonal anti-mouse TruStain FcX (Clone 93) BioLegend Cat#101319; Clone 93; RRID: AB_1574973 Anti-human TruStain FcX BioLegend Cat#422301; RRID: AB_2818986 Bacterial and virus strains MSCVneo-HA-ER-Hoxb8 Wang et al. 43 Addgene plasmid #222291; RRID: Addgene_222291 pKLV2-U6gRNA5(BbsI)PGKpuro2AmCherry-W Tzelepis et al. 77 Addgene plasmid #67977; RRID: Addgene_67977 pxpr_036_hCD19 This paper N/A pCMV delta R8.2 This paper Addgene plasmid #12263; RRID: Addgene_12263 VSV.G Reya et al. 78 Addgene plasmid #14888; RRID: Addgene_14888 pLV[Exp]-CMV>mCcl3[NM_011337.2]: WPRE-mPGK >Puro:T2A:mCherry This paper VectorBuilder plasmid #VB240515- 1674bdc Biological samples Human HNSCC FFPE samples MGH, MEE This study Human HNSCC samples MGH GSE234933 Chemicals, peptides, and recombinant proteins A-1331852 inhibitor MedChemExpress Cat#HY-19741 Navitoclax inhibitor MedChemExpress Cat#HY-10087 Polybrene Merck Millipore Cat#TR-1003-G Puromycin Sigma-Aldrich Cat#P8833 Fibronectin Sigma-Aldrich Cat#F-0895 FuGENE Transfection Reagent Promega Cat#E2311 β-estradiol Sigma-Aldrich Cat#50-28-2 Ficoll gradient Cytiva Cat#GE17-1440-02 RBC lysis buffer Invitrogen Cat#00-4333-57 ACK lysing buffer Gibco Cat#A1049201 Zombie Aqua BioLegend Cat#423101 Zombie UV BioLegend Cat#423107 Zombie NIR BioLegend Cat#423105 7-AAD BioLegend Cat#420403 Propidium iodide Invitrogen Cat#P1304MP DAPI Akoya Biosciences Cat#FP1490 DAPI ThermoFisher Scientific Cat#D21490 Giemsa Abcam Cat#ab150670 (Continued on next page) e3 Cancer Cell 44, 1–17.e1–e12, March 9, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hematoxylin Agilent Dako Cat#CS70030-2 Fluorescence mounting medium Agilent Dako Cat#S3023 Prolong Diamond Antifade Mounting ThermoFisher Scientific Cat#P36965 Annexin V-BV421 BioLegend Cat#640923 Pimonidazole (hypoxyprobeTM-1) Hypoxyprobe (Hpi) Cat#HP3-100 Recombinant mouse Flt3L PeproTech Cat#250-31L Recombinant mouse IL-7 PeproTech Cat#217-17 Recombinant mouse SCF PeproTech Cat#250-03 Recombinant mouse TPO PeproTech Cat#315-14 Recombinant mouse IL-6 STEMCELL Cat#78052.1 Recombinant mouse IL-3 PeproTech Cat#213-13 Critical commercial assays Human Tumor Dissociation kit Miltenyi Biotec Cat#130-095-929 EasySep Dead Cell Removal kit STEMCELL Cat#17899 10× Genomics Chromium Single Cell 5 ′ Library and Gel Bead Kit v1 chemistry 10× Genomics Cat#1000006 Chromium Single Cell 5 ′ Feature Barcode Library kit 10× Genomics Cat#1000080 Qubit dsDNA High Sensitivity kit Invitrogen Cat#Q32854 Agilent High Sensitivity BioA DNA kit Agilent Cat#5067-4626 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAquick PCR Purification Kit Qiagen Cat#28106 EnVision Flex Mini Kit, High pH Agilent Dako Cat#K8023 PrimeFlowTM RNA Assay Kit ThermoFisher Scientific Cat#88-18005-204 RNAscope Multiplex Fluorescent Reagent Kit v2 assay Advanced Cell Diagnostics Cat# #323100 RNAscope Multiplex Fluorescent V2 assay Bio-techne Cat#323110 miRNAeasy Mini kit Qiagen Cat#217004 RNeasy Plus Mini kit Qiagen Cat#74134 RNeasy UCP Micro Kit Qiagen Cat#73934 SuperScript IV VILO cDNA Synthesis kit Invitrogen Cat#11754250 Deposited data Human and mouse neutrophil scRNA data compendium This study Zenodo: https://doi.org/10.5281/zenodo.

Plasmid Preparation:

Article Title: Reconciling competing models on the roles of condensates and soluble complexes in transcription factor function.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA Gcn4 constructs for E. coli expression, see Table S1 This paper Addgene Plasmids #231856-231886, and #231888 pDEST17_FL Gcn4 This paper Addgene Plasmid #238155 pDEST17_Med15 This paper Addgene Plasmid #238187 pAG415Gal-ccdB Addgene Cat# 14145 pAG415GPD-ccdB-HA Addgene Cat# 14242 pFA6a-mEGFP-KanMX6 Addgene Cat# 87026 Software and algorithms Fiji ImageJ https://imagej.net BioRender BioRender https://www.biorender.com Adobe Illustrator Adobe https://www.adobe.com GraphPad Prism GraphPad https://www.graphpad.com Image Studio5 LICORbio https://www.licorbio.com/image-studio Design & Analysis 2.5.1 Applied Biosystems https://www.thermofisher.com Integrated Genomics Viewer (IGV) IGV https://igv.org/ OriginLab OriginLab https://www.originlab.com Other Waters HPLC 2489 Waters https://www.waters.com/nextgen/en/products/ chromatography/chromatography-systems.html Molecular Cell 85, 1–15.e1–e7, July 17, 2025 e2 Med15 7-659 Protein expression and purification in E. coli All Gcn4 variants were expressed in E. coli BL21-Gold (DE3) or BL21(DE3) pLysS strains in ZYM5052 auto induction media 78 at 37 ◦ C for 24 hours. ..

Article Title: Tunable metastability of condensates reconciles their dual roles in amyloid fibril formation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Plain Microscope Glass slides, Precleaned Fisher Scientific Cat# 12-550-10 Glass Coverslips VWR International LLC Cat# 48393-195 3M LSE double sided adhesive sheets 3M Cat# 9474LE Deposited data Code This paper https://github.com/Pappulab/ metastable-condensates Source data for all plots This paper https://github.com/Pappulab/ metastable-condensates Experimental models: Cell lines U2OS cells ATCC Cat# HTB-96; RRID: CVCL_0042 U2OS cells with G3BP1-tdTomato knock-in Yang et al. 1 N/A Recombinant DNA A1-LCD WT in pDEST17 This paper Addgene Plasmid #178658 A1-LCD D262V in pDEST17 This paper Addgene Plasmid #234607 A1-LCD D262N in pDEST17 This paper Addgene Plasmid #234608 A1-LCD − 4D+4V in pDEST17 This paper Addgene Plasmid #234610 A1-LCD − 4D+4N in pDEST17 This paper Addgene Plasmid #234611 A1-LCD − 3G1S+4V in pDEST17 This paper Addgene Plasmid #234612 A1-LCD − 3D+3V in pDEST17 This paper Addgene Plasmid #234613 A1-LCD − 3D+3N in pDEST17 This paper Addgene Plasmid #234614 A1-LCD allW in pDEST17 This paper Addgene Plasmid #234609 A1-LCD allW D262V in pDEST17 This paper Addgene Plasmid #234616 A1-LCD allW D262N in pDEST17 This paper Addgene Plasmid #234615 A1-LCD 11W D262V in pDEST17 This paper Addgene Plasmid #234618 A1-LCD 5W D262V in pDEST17 This paper Addgene Plasmid #234617 hnRNPA1_WT-FLAG-IRES-eGFP in pcDNA4/TO/myc-His A This paper Addgene Plasmid #234619 hnRNPA1_D262V-FLAG-IRES-eGFP in pcDNA4/TO/myc-His A This paper Addgene Plasmid #234620 hnRNPA1_allW_D262V-FLAG-IRES-eGFP in pcDNA4/TO/myc-His A This paper Addgene Plasmid #234621 Software and algorithms Ilastik (v1.4) https://www.ilastik.org/ N/A Cellpose (v2) https://www.cellpose.org/ N/A Fiji https://imagej.net/software/fiji/ N/A RStudio https://posit.co/download/rstudio-desktop/ N/A OriginPro 2024 https://www.originlab.com/ N/A Adobe Illustrator Adobe N/A e2 Molecular Cell 85, 1–16.e1–e7, June 5, 2025 Table S2. .. Cells were seeded in 35 mm glass bottom dishes (Thermo Fisher Cat# 150680) at a density of 400,000 cells per dish.

Formalin-fixed Paraffin-Embedded:

Recombinant:

Transfection:

Red Blood Cell Lysis:

Construct:

Expressing:

Software:

High Performance Liquid Chromatography:

Chromatography:

Purification:

other:

Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClickTM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5′-GTTCTTCTGCAGTCCACATAT-3′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5′-ACAGTTCGTGAGGTGGCTTTA-3′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This paper Addgene plasmid #12259 Plasmids psPAX2 This paper Addgene plasmid #12260 Software and algorithms GraphPad Prism 10.1.2 Graphpad software https://www.graphpad.com ImageJ N/A https://imagej.net/ij/.

Article Title: AI-generated MLH1 small binder improves prime editing efficiency.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 10X TBS Solution, pH 7.4 Welgene Cat#ML023-03 TWEEN® 20 Sigma-Aldrich Cat#P1379-100ML Proteinase K (Recombinant), Molecular/PCR Grade, AG scientific Cat#P-1264-100MG TRIS (Ultrapure) LPS solution Cat#T1503-1KG Nonidet® P 40 Substitute (NP-40), Reagent Grade Avantor Cat#E109-100ML Critical commercial assays ExprepTM Plasmid SV, 200prep GeneAll Cat#101-102 ExpinTM Gel SV, 200prep GeneAll Cat#102-102 ExpinTM PCR SV, 200prep GeneAll Cat#103-102 NucleoBond Xtra Midi EF, Midi kit MACHEREY-NAGEL Cat#740420.5 AccuPrep® Genomic DNA Extraction Kit Bioneer Cat#K-3032 PrimeScriptTM RT Master Mix (Perfect Real Time) Takara Cat#RR036A iTaq Universal SYBR Green Supermix Bio-Rad Cat#1725124 Gibson Assembly® Master Mix NEB Cat#E2611 Dead Cell Apoptosis Kits with Annexin V for Flow Cytometry Thermo Fisher Scientific Cat#V13241 FOXP3 Fix/Perm Buffer Set BioLegend Cat#421403 Annexin V binding buffer BioLegend Cat#422201 SMARTer Ultra-Low Input RNA Sample Prep Kit Clontech Cat#634940 SMARTScribeTM Reverse Transcriptase Clontech Cat#639536 NeonTM Transfection System Thermo Fisher Scientific Cat#MPK1096 MiniSeqTM Mid Output Kit (300 cycles) Illumina Cat#FC-420-1004 Deposited data Amplicon sequencing data This paper NCBI SRA: BioProject PRJNA1229090 Whole-genome sequencing data This paper NCBI SRA: BioProject PRJNA1229090 RNA-seq data This paper NCBI SRA: BioProject PRJNA1229090 Experimental models: Cell lines Human (female): HEK293T ATCC Cat#CRL-3216 Human (female): HeLa ATCC Cat#CCL-2 Human (female): HEK293 ATCC Cat#CRL-1573 Primary human fibroblast Seoul National University Hospital IRB-H-0905-041-281 human iPSC (female) Catholic University of Korea CMC-hiPSC-022 Experimental models: Organisms/strains Female Institute of Cancer Research (ICR) mice Orient Bio Cat#2160272 Recombinant DNA pCMV-PE2 Addgene Addgene plasmid #132775 pCMV-PEmax Addgene Addgene plasmid #174820 pCMV-PE6b Addgene Addgene plasmid #207852 pCMV-PE6c Addgene Addgene plasmid #207853 pCMV-PE6d Addgene Addgene plasmid #207854 pCMV-PuroR-2A-MLH1-SB This paper Addgene plasmid #228871 pCMV-PE7-SB This paper Addgene plasmid #228869 pCMV-PE7-SB-NLS This paper Addgene plasmid #228870 pCMV-PE7-SB2 This paper Addgene plasmid #228868 Software and algorithms Cas-Analyzer Park et al. 52 http://www.rgenome.net/cas-analyzer/ (Continued on next page) ll OPEN ACCESS e2 Cell 188, 1–16.e1–e6, October 16, 2025 Please cite this article in press as: Park et al., AI-generated MLH1 small binder improves prime editing efficiency, Cell (2025), https://doi.org/ 10.1016/j.cell.2025.07.010 Article

Article Title: Tunable metastability of condensates reconciles their dual roles in amyloid fibril formation.
Article Snippet: Cells were seeded in 35 mm glass bottom dishes (Thermo Fisher Cat# 150680) at a density of 400,000 cells per dish.

Review